ID: 994380395

View in Genome Browser
Species Human (GRCh38)
Location 5:99063977-99063999
Sequence TTCCTAATGAGGCCTTGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994380395_994380398 13 Left 994380395 5:99063977-99063999 CCACTGCAAGGCCTCATTAGGAA No data
Right 994380398 5:99064013-99064035 TTCCGTAACAGATCCAATGTAGG No data
994380395_994380400 21 Left 994380395 5:99063977-99063999 CCACTGCAAGGCCTCATTAGGAA No data
Right 994380400 5:99064021-99064043 CAGATCCAATGTAGGATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994380395 Original CRISPR TTCCTAATGAGGCCTTGCAG TGG (reversed) Intergenic
No off target data available for this crispr