ID: 994380397

View in Genome Browser
Species Human (GRCh38)
Location 5:99064001-99064023
Sequence CTGTTACGGAAAAGAAAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994380397_994380400 -3 Left 994380397 5:99064001-99064023 CCTAGTTTTCTTTTCCGTAACAG No data
Right 994380400 5:99064021-99064043 CAGATCCAATGTAGGATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994380397 Original CRISPR CTGTTACGGAAAAGAAAACT AGG (reversed) Intergenic
No off target data available for this crispr