ID: 994380398

View in Genome Browser
Species Human (GRCh38)
Location 5:99064013-99064035
Sequence TTCCGTAACAGATCCAATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994380396_994380398 2 Left 994380396 5:99063988-99064010 CCTCATTAGGAATCCTAGTTTTC No data
Right 994380398 5:99064013-99064035 TTCCGTAACAGATCCAATGTAGG No data
994380394_994380398 14 Left 994380394 5:99063976-99063998 CCCACTGCAAGGCCTCATTAGGA No data
Right 994380398 5:99064013-99064035 TTCCGTAACAGATCCAATGTAGG No data
994380392_994380398 15 Left 994380392 5:99063975-99063997 CCCCACTGCAAGGCCTCATTAGG No data
Right 994380398 5:99064013-99064035 TTCCGTAACAGATCCAATGTAGG No data
994380395_994380398 13 Left 994380395 5:99063977-99063999 CCACTGCAAGGCCTCATTAGGAA No data
Right 994380398 5:99064013-99064035 TTCCGTAACAGATCCAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994380398 Original CRISPR TTCCGTAACAGATCCAATGT AGG Intergenic
No off target data available for this crispr