ID: 994380400

View in Genome Browser
Species Human (GRCh38)
Location 5:99064021-99064043
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994380397_994380400 -3 Left 994380397 5:99064001-99064023 CCTAGTTTTCTTTTCCGTAACAG No data
Right 994380400 5:99064021-99064043 CAGATCCAATGTAGGATTTATGG No data
994380392_994380400 23 Left 994380392 5:99063975-99063997 CCCCACTGCAAGGCCTCATTAGG No data
Right 994380400 5:99064021-99064043 CAGATCCAATGTAGGATTTATGG No data
994380396_994380400 10 Left 994380396 5:99063988-99064010 CCTCATTAGGAATCCTAGTTTTC No data
Right 994380400 5:99064021-99064043 CAGATCCAATGTAGGATTTATGG No data
994380394_994380400 22 Left 994380394 5:99063976-99063998 CCCACTGCAAGGCCTCATTAGGA No data
Right 994380400 5:99064021-99064043 CAGATCCAATGTAGGATTTATGG No data
994380395_994380400 21 Left 994380395 5:99063977-99063999 CCACTGCAAGGCCTCATTAGGAA No data
Right 994380400 5:99064021-99064043 CAGATCCAATGTAGGATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type