ID: 994381735

View in Genome Browser
Species Human (GRCh38)
Location 5:99079560-99079582
Sequence CTGTCTATGCTGGAGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994381730_994381735 14 Left 994381730 5:99079523-99079545 CCTACTTCCAGCATGTGAGGACA No data
Right 994381735 5:99079560-99079582 CTGTCTATGCTGGAGGAAGTGGG No data
994381724_994381735 30 Left 994381724 5:99079507-99079529 CCCAGACACTTCCCTCCCTACTT No data
Right 994381735 5:99079560-99079582 CTGTCTATGCTGGAGGAAGTGGG No data
994381725_994381735 29 Left 994381725 5:99079508-99079530 CCAGACACTTCCCTCCCTACTTC No data
Right 994381735 5:99079560-99079582 CTGTCTATGCTGGAGGAAGTGGG No data
994381726_994381735 19 Left 994381726 5:99079518-99079540 CCCTCCCTACTTCCAGCATGTGA No data
Right 994381735 5:99079560-99079582 CTGTCTATGCTGGAGGAAGTGGG No data
994381727_994381735 18 Left 994381727 5:99079519-99079541 CCTCCCTACTTCCAGCATGTGAG No data
Right 994381735 5:99079560-99079582 CTGTCTATGCTGGAGGAAGTGGG No data
994381729_994381735 15 Left 994381729 5:99079522-99079544 CCCTACTTCCAGCATGTGAGGAC No data
Right 994381735 5:99079560-99079582 CTGTCTATGCTGGAGGAAGTGGG No data
994381731_994381735 7 Left 994381731 5:99079530-99079552 CCAGCATGTGAGGACACAGTGAG No data
Right 994381735 5:99079560-99079582 CTGTCTATGCTGGAGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994381735 Original CRISPR CTGTCTATGCTGGAGGAAGT GGG Intergenic
No off target data available for this crispr