ID: 994385652

View in Genome Browser
Species Human (GRCh38)
Location 5:99128353-99128375
Sequence CCTCATACAATCAAGGCAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994385652_994385656 1 Left 994385652 5:99128353-99128375 CCGTCTGCCTTGATTGTATGAGG No data
Right 994385656 5:99128377-99128399 TACATGGATAAGTTCTTTAGTGG 0: 290
1: 1020
2: 1972
3: 1779
4: 1482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994385652 Original CRISPR CCTCATACAATCAAGGCAGA CGG (reversed) Intergenic
No off target data available for this crispr