ID: 994385656

View in Genome Browser
Species Human (GRCh38)
Location 5:99128377-99128399
Sequence TACATGGATAAGTTCTTTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6543
Summary {0: 290, 1: 1020, 2: 1972, 3: 1779, 4: 1482}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994385652_994385656 1 Left 994385652 5:99128353-99128375 CCGTCTGCCTTGATTGTATGAGG No data
Right 994385656 5:99128377-99128399 TACATGGATAAGTTCTTTAGTGG 0: 290
1: 1020
2: 1972
3: 1779
4: 1482
994385650_994385656 21 Left 994385650 5:99128333-99128355 CCTGACCTGTCTCATTGGTACCG No data
Right 994385656 5:99128377-99128399 TACATGGATAAGTTCTTTAGTGG 0: 290
1: 1020
2: 1972
3: 1779
4: 1482
994385648_994385656 30 Left 994385648 5:99128324-99128346 CCTCATTCTCCTGACCTGTCTCA No data
Right 994385656 5:99128377-99128399 TACATGGATAAGTTCTTTAGTGG 0: 290
1: 1020
2: 1972
3: 1779
4: 1482
994385651_994385656 16 Left 994385651 5:99128338-99128360 CCTGTCTCATTGGTACCGTCTGC No data
Right 994385656 5:99128377-99128399 TACATGGATAAGTTCTTTAGTGG 0: 290
1: 1020
2: 1972
3: 1779
4: 1482
994385654_994385656 -6 Left 994385654 5:99128360-99128382 CCTTGATTGTATGAGGTTACATG No data
Right 994385656 5:99128377-99128399 TACATGGATAAGTTCTTTAGTGG 0: 290
1: 1020
2: 1972
3: 1779
4: 1482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994385656 Original CRISPR TACATGGATAAGTTCTTTAG TGG Intergenic
Too many off-targets to display for this crispr