ID: 994389948

View in Genome Browser
Species Human (GRCh38)
Location 5:99180520-99180542
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994389948_994389950 13 Left 994389948 5:99180520-99180542 CCACACTATGTCCATGTGTATAC No data
Right 994389950 5:99180556-99180578 CACTTTTAAGTGAATACATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994389948 Original CRISPR GTATACACATGGACATAGTG TGG (reversed) Intergenic
No off target data available for this crispr