ID: 994391470

View in Genome Browser
Species Human (GRCh38)
Location 5:99197396-99197418
Sequence TATTGTTTGTAATAGACAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994391470_994391477 -9 Left 994391470 5:99197396-99197418 CCCCCTGTCTATTACAAACAATA No data
Right 994391477 5:99197410-99197432 CAAACAATATAACAGGAGGGTGG No data
994391470_994391478 10 Left 994391470 5:99197396-99197418 CCCCCTGTCTATTACAAACAATA No data
Right 994391478 5:99197429-99197451 GTGGACACCCTCTGCCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994391470 Original CRISPR TATTGTTTGTAATAGACAGG GGG (reversed) Intergenic
No off target data available for this crispr