ID: 994391472

View in Genome Browser
Species Human (GRCh38)
Location 5:99197398-99197420
Sequence TATATTGTTTGTAATAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994391472_994391478 8 Left 994391472 5:99197398-99197420 CCCTGTCTATTACAAACAATATA No data
Right 994391478 5:99197429-99197451 GTGGACACCCTCTGCCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994391472 Original CRISPR TATATTGTTTGTAATAGACA GGG (reversed) Intergenic
No off target data available for this crispr