ID: 994391478

View in Genome Browser
Species Human (GRCh38)
Location 5:99197429-99197451
Sequence GTGGACACCCTCTGCCATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994391471_994391478 9 Left 994391471 5:99197397-99197419 CCCCTGTCTATTACAAACAATAT No data
Right 994391478 5:99197429-99197451 GTGGACACCCTCTGCCATATTGG No data
994391473_994391478 7 Left 994391473 5:99197399-99197421 CCTGTCTATTACAAACAATATAA No data
Right 994391478 5:99197429-99197451 GTGGACACCCTCTGCCATATTGG No data
994391472_994391478 8 Left 994391472 5:99197398-99197420 CCCTGTCTATTACAAACAATATA No data
Right 994391478 5:99197429-99197451 GTGGACACCCTCTGCCATATTGG No data
994391470_994391478 10 Left 994391470 5:99197396-99197418 CCCCCTGTCTATTACAAACAATA No data
Right 994391478 5:99197429-99197451 GTGGACACCCTCTGCCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994391478 Original CRISPR GTGGACACCCTCTGCCATAT TGG Intergenic
No off target data available for this crispr