ID: 994393340

View in Genome Browser
Species Human (GRCh38)
Location 5:99209363-99209385
Sequence GTGGACACCCACTGTGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994393334_994393340 18 Left 994393334 5:99209322-99209344 CCACTTTTCTTCTGGATATTAGG No data
Right 994393340 5:99209363-99209385 GTGGACACCCACTGTGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994393340 Original CRISPR GTGGACACCCACTGTGATAT TGG Intergenic
No off target data available for this crispr