ID: 994395510

View in Genome Browser
Species Human (GRCh38)
Location 5:99223216-99223238
Sequence CCTAATAAGCAGGGAGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994395510_994395517 -9 Left 994395510 5:99223216-99223238 CCTTCCCCTCCCTGCTTATTAGG No data
Right 994395517 5:99223230-99223252 CTTATTAGGAACAACATCTCAGG No data
994395510_994395519 19 Left 994395510 5:99223216-99223238 CCTTCCCCTCCCTGCTTATTAGG No data
Right 994395519 5:99223258-99223280 TGTACACCCCCTGCTATATTGGG No data
994395510_994395518 18 Left 994395510 5:99223216-99223238 CCTTCCCCTCCCTGCTTATTAGG No data
Right 994395518 5:99223257-99223279 GTGTACACCCCCTGCTATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994395510 Original CRISPR CCTAATAAGCAGGGAGGGGA AGG (reversed) Intergenic
No off target data available for this crispr