ID: 994395896

View in Genome Browser
Species Human (GRCh38)
Location 5:99225550-99225572
Sequence CCTGATATGCAGAGGGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994395896_994395905 17 Left 994395896 5:99225550-99225572 CCTTTCCCCCTCTGCATATCAGG No data
Right 994395905 5:99225590-99225612 GTGTACACCCCCTATGATATTGG No data
994395896_994395902 -9 Left 994395896 5:99225550-99225572 CCTTTCCCCCTCTGCATATCAGG No data
Right 994395902 5:99225564-99225586 CATATCAGGAACAATATCTCAGG No data
994395896_994395903 -8 Left 994395896 5:99225550-99225572 CCTTTCCCCCTCTGCATATCAGG No data
Right 994395903 5:99225565-99225587 ATATCAGGAACAATATCTCAGGG No data
994395896_994395906 18 Left 994395896 5:99225550-99225572 CCTTTCCCCCTCTGCATATCAGG No data
Right 994395906 5:99225591-99225613 TGTACACCCCCTATGATATTGGG No data
994395896_994395904 -5 Left 994395896 5:99225550-99225572 CCTTTCCCCCTCTGCATATCAGG No data
Right 994395904 5:99225568-99225590 TCAGGAACAATATCTCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994395896 Original CRISPR CCTGATATGCAGAGGGGGAA AGG (reversed) Intergenic
No off target data available for this crispr