ID: 994395902

View in Genome Browser
Species Human (GRCh38)
Location 5:99225564-99225586
Sequence CATATCAGGAACAATATCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994395895_994395902 16 Left 994395895 5:99225525-99225547 CCTGCGATATTGGATGTAACAAA No data
Right 994395902 5:99225564-99225586 CATATCAGGAACAATATCTCAGG No data
994395896_994395902 -9 Left 994395896 5:99225550-99225572 CCTTTCCCCCTCTGCATATCAGG No data
Right 994395902 5:99225564-99225586 CATATCAGGAACAATATCTCAGG No data
994395893_994395902 22 Left 994395893 5:99225519-99225541 CCACTCCCTGCGATATTGGATGT No data
Right 994395902 5:99225564-99225586 CATATCAGGAACAATATCTCAGG No data
994395894_994395902 17 Left 994395894 5:99225524-99225546 CCCTGCGATATTGGATGTAACAA No data
Right 994395902 5:99225564-99225586 CATATCAGGAACAATATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994395902 Original CRISPR CATATCAGGAACAATATCTC AGG Intergenic
No off target data available for this crispr