ID: 994395903

View in Genome Browser
Species Human (GRCh38)
Location 5:99225565-99225587
Sequence ATATCAGGAACAATATCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994395893_994395903 23 Left 994395893 5:99225519-99225541 CCACTCCCTGCGATATTGGATGT No data
Right 994395903 5:99225565-99225587 ATATCAGGAACAATATCTCAGGG No data
994395894_994395903 18 Left 994395894 5:99225524-99225546 CCCTGCGATATTGGATGTAACAA No data
Right 994395903 5:99225565-99225587 ATATCAGGAACAATATCTCAGGG No data
994395896_994395903 -8 Left 994395896 5:99225550-99225572 CCTTTCCCCCTCTGCATATCAGG No data
Right 994395903 5:99225565-99225587 ATATCAGGAACAATATCTCAGGG No data
994395895_994395903 17 Left 994395895 5:99225525-99225547 CCTGCGATATTGGATGTAACAAA No data
Right 994395903 5:99225565-99225587 ATATCAGGAACAATATCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994395903 Original CRISPR ATATCAGGAACAATATCTCA GGG Intergenic
No off target data available for this crispr