ID: 994395904

View in Genome Browser
Species Human (GRCh38)
Location 5:99225568-99225590
Sequence TCAGGAACAATATCTCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994395893_994395904 26 Left 994395893 5:99225519-99225541 CCACTCCCTGCGATATTGGATGT No data
Right 994395904 5:99225568-99225590 TCAGGAACAATATCTCAGGGAGG No data
994395894_994395904 21 Left 994395894 5:99225524-99225546 CCCTGCGATATTGGATGTAACAA No data
Right 994395904 5:99225568-99225590 TCAGGAACAATATCTCAGGGAGG No data
994395896_994395904 -5 Left 994395896 5:99225550-99225572 CCTTTCCCCCTCTGCATATCAGG No data
Right 994395904 5:99225568-99225590 TCAGGAACAATATCTCAGGGAGG No data
994395895_994395904 20 Left 994395895 5:99225525-99225547 CCTGCGATATTGGATGTAACAAA No data
Right 994395904 5:99225568-99225590 TCAGGAACAATATCTCAGGGAGG No data
994395898_994395904 -10 Left 994395898 5:99225555-99225577 CCCCCTCTGCATATCAGGAACAA No data
Right 994395904 5:99225568-99225590 TCAGGAACAATATCTCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994395904 Original CRISPR TCAGGAACAATATCTCAGGG AGG Intergenic
No off target data available for this crispr