ID: 994395906

View in Genome Browser
Species Human (GRCh38)
Location 5:99225591-99225613
Sequence TGTACACCCCCTATGATATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994395899_994395906 12 Left 994395899 5:99225556-99225578 CCCCTCTGCATATCAGGAACAAT No data
Right 994395906 5:99225591-99225613 TGTACACCCCCTATGATATTGGG No data
994395901_994395906 10 Left 994395901 5:99225558-99225580 CCTCTGCATATCAGGAACAATAT No data
Right 994395906 5:99225591-99225613 TGTACACCCCCTATGATATTGGG No data
994395900_994395906 11 Left 994395900 5:99225557-99225579 CCCTCTGCATATCAGGAACAATA No data
Right 994395906 5:99225591-99225613 TGTACACCCCCTATGATATTGGG No data
994395896_994395906 18 Left 994395896 5:99225550-99225572 CCTTTCCCCCTCTGCATATCAGG No data
Right 994395906 5:99225591-99225613 TGTACACCCCCTATGATATTGGG No data
994395898_994395906 13 Left 994395898 5:99225555-99225577 CCCCCTCTGCATATCAGGAACAA No data
Right 994395906 5:99225591-99225613 TGTACACCCCCTATGATATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994395906 Original CRISPR TGTACACCCCCTATGATATT GGG Intergenic
No off target data available for this crispr