ID: 994406552

View in Genome Browser
Species Human (GRCh38)
Location 5:99352594-99352616
Sequence GGCCCACTCATGGCTGCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994406552_994406558 20 Left 994406552 5:99352594-99352616 CCAAGGGCAGCCATGAGTGGGCC No data
Right 994406558 5:99352637-99352659 TTCACTCCAGTCCACAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994406552 Original CRISPR GGCCCACTCATGGCTGCCCT TGG (reversed) Intergenic
No off target data available for this crispr