ID: 994406554

View in Genome Browser
Species Human (GRCh38)
Location 5:99352604-99352626
Sequence GGTTTTTCCAGGCCCACTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994406554_994406558 10 Left 994406554 5:99352604-99352626 CCATGAGTGGGCCTGGAAAAACC No data
Right 994406558 5:99352637-99352659 TTCACTCCAGTCCACAGAACTGG No data
994406554_994406561 26 Left 994406554 5:99352604-99352626 CCATGAGTGGGCCTGGAAAAACC No data
Right 994406561 5:99352653-99352675 GAACTGGTAGCCCAACACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994406554 Original CRISPR GGTTTTTCCAGGCCCACTCA TGG (reversed) Intergenic
No off target data available for this crispr