ID: 994406555

View in Genome Browser
Species Human (GRCh38)
Location 5:99352615-99352637
Sequence AAACTTATGGTGGTTTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994406555_994406558 -1 Left 994406555 5:99352615-99352637 CCTGGAAAAACCACCATAAGTTT No data
Right 994406558 5:99352637-99352659 TTCACTCCAGTCCACAGAACTGG No data
994406555_994406561 15 Left 994406555 5:99352615-99352637 CCTGGAAAAACCACCATAAGTTT No data
Right 994406561 5:99352653-99352675 GAACTGGTAGCCCAACACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994406555 Original CRISPR AAACTTATGGTGGTTTTTCC AGG (reversed) Intergenic
No off target data available for this crispr