ID: 994406558

View in Genome Browser
Species Human (GRCh38)
Location 5:99352637-99352659
Sequence TTCACTCCAGTCCACAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994406552_994406558 20 Left 994406552 5:99352594-99352616 CCAAGGGCAGCCATGAGTGGGCC No data
Right 994406558 5:99352637-99352659 TTCACTCCAGTCCACAGAACTGG No data
994406555_994406558 -1 Left 994406555 5:99352615-99352637 CCTGGAAAAACCACCATAAGTTT No data
Right 994406558 5:99352637-99352659 TTCACTCCAGTCCACAGAACTGG No data
994406554_994406558 10 Left 994406554 5:99352604-99352626 CCATGAGTGGGCCTGGAAAAACC No data
Right 994406558 5:99352637-99352659 TTCACTCCAGTCCACAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994406558 Original CRISPR TTCACTCCAGTCCACAGAAC TGG Intergenic
No off target data available for this crispr