ID: 994409597

View in Genome Browser
Species Human (GRCh38)
Location 5:99390413-99390435
Sequence GCTGAAGTCAAGCCTATTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994409597_994409599 17 Left 994409597 5:99390413-99390435 CCTAAAATAGGCTTGACTTCAGC No data
Right 994409599 5:99390453-99390475 TCCTCATTCCGAGCCTTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994409597 Original CRISPR GCTGAAGTCAAGCCTATTTT AGG (reversed) Intergenic
No off target data available for this crispr