ID: 994411339

View in Genome Browser
Species Human (GRCh38)
Location 5:99410504-99410526
Sequence CCTCTGGGCTGCCTGAGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994411339_994411348 15 Left 994411339 5:99410504-99410526 CCGGCGCTCAGGCAGCCCAGAGG No data
Right 994411348 5:99410542-99410564 CAAGTCCAGCAGGCGCCGGCTGG No data
994411339_994411344 5 Left 994411339 5:99410504-99410526 CCGGCGCTCAGGCAGCCCAGAGG No data
Right 994411344 5:99410532-99410554 AGTCCCTGATCAAGTCCAGCAGG No data
994411339_994411347 11 Left 994411339 5:99410504-99410526 CCGGCGCTCAGGCAGCCCAGAGG No data
Right 994411347 5:99410538-99410560 TGATCAAGTCCAGCAGGCGCCGG No data
994411339_994411351 30 Left 994411339 5:99410504-99410526 CCGGCGCTCAGGCAGCCCAGAGG No data
Right 994411351 5:99410557-99410579 CCGGCTGGCCGAGCCGAGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994411339 Original CRISPR CCTCTGGGCTGCCTGAGCGC CGG (reversed) Intergenic