ID: 994411995

View in Genome Browser
Species Human (GRCh38)
Location 5:99418286-99418308
Sequence CCTGGTTACCAGCATTGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994411995_994411997 -7 Left 994411995 5:99418286-99418308 CCACTGCAATGCTGGTAACCAGG No data
Right 994411997 5:99418302-99418324 AACCAGGAGAAGAATGAGAACGG No data
994411995_994411999 -2 Left 994411995 5:99418286-99418308 CCACTGCAATGCTGGTAACCAGG No data
Right 994411999 5:99418307-99418329 GGAGAAGAATGAGAACGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994411995 Original CRISPR CCTGGTTACCAGCATTGCAG TGG (reversed) Intergenic
No off target data available for this crispr