ID: 994412961

View in Genome Browser
Species Human (GRCh38)
Location 5:99432383-99432405
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994412958_994412961 -4 Left 994412958 5:99432364-99432386 CCTCTATCTCTCATTTTGTTCTG No data
Right 994412961 5:99432383-99432405 TCTGAACTCATGAAGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr