ID: 994417983

View in Genome Browser
Species Human (GRCh38)
Location 5:99498970-99498992
Sequence AATCCCACCCCCTATGTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994417983_994417986 -6 Left 994417983 5:99498970-99498992 CCTATAACATAGGGGGTGGGATT No data
Right 994417986 5:99498987-99499009 GGGATTAAAGAACAGAAATGGGG No data
994417983_994417987 -5 Left 994417983 5:99498970-99498992 CCTATAACATAGGGGGTGGGATT No data
Right 994417987 5:99498988-99499010 GGATTAAAGAACAGAAATGGGGG No data
994417983_994417984 -8 Left 994417983 5:99498970-99498992 CCTATAACATAGGGGGTGGGATT No data
Right 994417984 5:99498985-99499007 GTGGGATTAAAGAACAGAAATGG No data
994417983_994417985 -7 Left 994417983 5:99498970-99498992 CCTATAACATAGGGGGTGGGATT No data
Right 994417985 5:99498986-99499008 TGGGATTAAAGAACAGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994417983 Original CRISPR AATCCCACCCCCTATGTTAT AGG (reversed) Intergenic
No off target data available for this crispr