ID: 994420349

View in Genome Browser
Species Human (GRCh38)
Location 5:99523100-99523122
Sequence CAGCTGCAGCAGGTGCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994420349_994420353 1 Left 994420349 5:99523100-99523122 CCTCTGGGCACCTGCTGCAGCTG No data
Right 994420353 5:99523124-99523146 GGCTGAGGCCCAGAAATATGAGG No data
994420349_994420355 3 Left 994420349 5:99523100-99523122 CCTCTGGGCACCTGCTGCAGCTG No data
Right 994420355 5:99523126-99523148 CTGAGGCCCAGAAATATGAGGGG No data
994420349_994420354 2 Left 994420349 5:99523100-99523122 CCTCTGGGCACCTGCTGCAGCTG No data
Right 994420354 5:99523125-99523147 GCTGAGGCCCAGAAATATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994420349 Original CRISPR CAGCTGCAGCAGGTGCCCAG AGG (reversed) Intergenic
No off target data available for this crispr