ID: 994420354

View in Genome Browser
Species Human (GRCh38)
Location 5:99523125-99523147
Sequence GCTGAGGCCCAGAAATATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994420352_994420354 -8 Left 994420352 5:99523110-99523132 CCTGCTGCAGCTGTGGCTGAGGC No data
Right 994420354 5:99523125-99523147 GCTGAGGCCCAGAAATATGAGGG No data
994420349_994420354 2 Left 994420349 5:99523100-99523122 CCTCTGGGCACCTGCTGCAGCTG No data
Right 994420354 5:99523125-99523147 GCTGAGGCCCAGAAATATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994420354 Original CRISPR GCTGAGGCCCAGAAATATGA GGG Intergenic
No off target data available for this crispr