ID: 994420522

View in Genome Browser
Species Human (GRCh38)
Location 5:99523944-99523966
Sequence GCTGAGGCCCAGAAATATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994420520_994420522 -8 Left 994420520 5:99523929-99523951 CCTGCTGCAGCTGTGGCTGAGGC No data
Right 994420522 5:99523944-99523966 GCTGAGGCCCAGAAATATGAGGG No data
994420517_994420522 2 Left 994420517 5:99523919-99523941 CCTCTGGGCACCTGCTGCAGCTG No data
Right 994420522 5:99523944-99523966 GCTGAGGCCCAGAAATATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994420522 Original CRISPR GCTGAGGCCCAGAAATATGA GGG Intergenic
No off target data available for this crispr