ID: 994420522 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:99523944-99523966 |
| Sequence | GCTGAGGCCCAGAAATATGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 994420520_994420522 | -8 | Left | 994420520 | 5:99523929-99523951 | CCTGCTGCAGCTGTGGCTGAGGC | No data | ||
| Right | 994420522 | 5:99523944-99523966 | GCTGAGGCCCAGAAATATGAGGG | No data | ||||
| 994420517_994420522 | 2 | Left | 994420517 | 5:99523919-99523941 | CCTCTGGGCACCTGCTGCAGCTG | No data | ||
| Right | 994420522 | 5:99523944-99523966 | GCTGAGGCCCAGAAATATGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 994420522 | Original CRISPR | GCTGAGGCCCAGAAATATGA GGG | Intergenic | ||
| No off target data available for this crispr | |||||