ID: 994424827

View in Genome Browser
Species Human (GRCh38)
Location 5:99572076-99572098
Sequence TTGAATAGGCATGGTGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994424827_994424832 18 Left 994424827 5:99572076-99572098 CCACCCTCACCATGCCTATTCAA No data
Right 994424832 5:99572117-99572139 AGCCAAAGCAATGAAGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994424827 Original CRISPR TTGAATAGGCATGGTGAGGG TGG (reversed) Intergenic
No off target data available for this crispr