ID: 994427648

View in Genome Browser
Species Human (GRCh38)
Location 5:99613811-99613833
Sequence GTGTTCAAATATTCATCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994427648_994427649 -9 Left 994427648 5:99613811-99613833 CCTGAAGATGAATATTTGAACAC No data
Right 994427649 5:99613825-99613847 TTTGAACACTCTTCACATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994427648 Original CRISPR GTGTTCAAATATTCATCTTC AGG (reversed) Intergenic
No off target data available for this crispr