ID: 994430978

View in Genome Browser
Species Human (GRCh38)
Location 5:99660990-99661012
Sequence TGTTAGCTTGAGCGCTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994430976_994430978 -2 Left 994430976 5:99660969-99660991 CCTTAGAGGCAAATTTTAATGTG No data
Right 994430978 5:99660990-99661012 TGTTAGCTTGAGCGCTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994430978 Original CRISPR TGTTAGCTTGAGCGCTTGGA TGG Intergenic
No off target data available for this crispr