ID: 994432496

View in Genome Browser
Species Human (GRCh38)
Location 5:99685425-99685447
Sequence GCTAAAAGTTTCCCCAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994432496_994432500 3 Left 994432496 5:99685425-99685447 CCTGGCTTGGGGAAACTTTTAGC No data
Right 994432500 5:99685451-99685473 TAGACAGTGCCTGTCGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994432496 Original CRISPR GCTAAAAGTTTCCCCAAGCC AGG (reversed) Intergenic