ID: 994436364

View in Genome Browser
Species Human (GRCh38)
Location 5:99738756-99738778
Sequence TCTGTGACCACTGGAACTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994436364_994436367 15 Left 994436364 5:99738756-99738778 CCTAAAGTTCCAGTGGTCACAGA No data
Right 994436367 5:99738794-99738816 AAGAATCATGGAGAGCTTCAAGG No data
994436364_994436366 3 Left 994436364 5:99738756-99738778 CCTAAAGTTCCAGTGGTCACAGA No data
Right 994436366 5:99738782-99738804 GTATTTGAACTGAAGAATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994436364 Original CRISPR TCTGTGACCACTGGAACTTT AGG (reversed) Intergenic
No off target data available for this crispr