ID: 994436366 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:99738782-99738804 |
| Sequence | GTATTTGAACTGAAGAATCA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 994436365_994436366 | -6 | Left | 994436365 | 5:99738765-99738787 | CCAGTGGTCACAGAACAGTATTT | No data | ||
| Right | 994436366 | 5:99738782-99738804 | GTATTTGAACTGAAGAATCATGG | No data | ||||
| 994436364_994436366 | 3 | Left | 994436364 | 5:99738756-99738778 | CCTAAAGTTCCAGTGGTCACAGA | No data | ||
| Right | 994436366 | 5:99738782-99738804 | GTATTTGAACTGAAGAATCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 994436366 | Original CRISPR | GTATTTGAACTGAAGAATCA TGG | Intergenic | ||
| No off target data available for this crispr | |||||