ID: 994436366

View in Genome Browser
Species Human (GRCh38)
Location 5:99738782-99738804
Sequence GTATTTGAACTGAAGAATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994436365_994436366 -6 Left 994436365 5:99738765-99738787 CCAGTGGTCACAGAACAGTATTT No data
Right 994436366 5:99738782-99738804 GTATTTGAACTGAAGAATCATGG No data
994436364_994436366 3 Left 994436364 5:99738756-99738778 CCTAAAGTTCCAGTGGTCACAGA No data
Right 994436366 5:99738782-99738804 GTATTTGAACTGAAGAATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994436366 Original CRISPR GTATTTGAACTGAAGAATCA TGG Intergenic
No off target data available for this crispr