ID: 994440619

View in Genome Browser
Species Human (GRCh38)
Location 5:99798933-99798955
Sequence CATAACCCTGCATCTTTCTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994440617_994440619 18 Left 994440617 5:99798892-99798914 CCATGAATTCTGGGTGACTATAT No data
Right 994440619 5:99798933-99798955 CATAACCCTGCATCTTTCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994440619 Original CRISPR CATAACCCTGCATCTTTCTA CGG Intergenic
No off target data available for this crispr