ID: 994442349

View in Genome Browser
Species Human (GRCh38)
Location 5:99825335-99825357
Sequence ACACCTTCCTGGACACATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994442349_994442353 9 Left 994442349 5:99825335-99825357 CCAATATGTGTCCAGGAAGGTGT No data
Right 994442353 5:99825367-99825389 GGGAAGATGACAAAAGATGTTGG No data
994442349_994442354 15 Left 994442349 5:99825335-99825357 CCAATATGTGTCCAGGAAGGTGT No data
Right 994442354 5:99825373-99825395 ATGACAAAAGATGTTGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994442349 Original CRISPR ACACCTTCCTGGACACATAT TGG (reversed) Intergenic
No off target data available for this crispr