ID: 994445299

View in Genome Browser
Species Human (GRCh38)
Location 5:99864585-99864607
Sequence CAAGGCAAAGACTCTGTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994445299_994445301 30 Left 994445299 5:99864585-99864607 CCATAAACAGAGTCTTTGCCTTG No data
Right 994445301 5:99864638-99864660 ATACTAGAGCCCTGTTAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994445299 Original CRISPR CAAGGCAAAGACTCTGTTTA TGG (reversed) Intergenic
No off target data available for this crispr