ID: 994447161

View in Genome Browser
Species Human (GRCh38)
Location 5:99891006-99891028
Sequence CAGGGTGAGCATGCTGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994447161_994447165 10 Left 994447161 5:99891006-99891028 CCTGCAACAGCATGCTCACCCTG No data
Right 994447165 5:99891039-99891061 CACGTTTATGATGAGTATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994447161 Original CRISPR CAGGGTGAGCATGCTGTTGC AGG (reversed) Intergenic
No off target data available for this crispr