ID: 994452136

View in Genome Browser
Species Human (GRCh38)
Location 5:99956036-99956058
Sequence GGCAAGCATGGGAGTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994452136_994452149 13 Left 994452136 5:99956036-99956058 CCAGCCTCACTCCCATGCTTGCC No data
Right 994452149 5:99956072-99956094 CATAGGGCACCAGGGTGGCAGGG No data
994452136_994452140 -4 Left 994452136 5:99956036-99956058 CCAGCCTCACTCCCATGCTTGCC No data
Right 994452140 5:99956055-99956077 TGCCAGCGTCCAAAGTCCATAGG No data
994452136_994452141 -3 Left 994452136 5:99956036-99956058 CCAGCCTCACTCCCATGCTTGCC No data
Right 994452141 5:99956056-99956078 GCCAGCGTCCAAAGTCCATAGGG No data
994452136_994452145 5 Left 994452136 5:99956036-99956058 CCAGCCTCACTCCCATGCTTGCC No data
Right 994452145 5:99956064-99956086 CCAAAGTCCATAGGGCACCAGGG No data
994452136_994452151 17 Left 994452136 5:99956036-99956058 CCAGCCTCACTCCCATGCTTGCC No data
Right 994452151 5:99956076-99956098 GGGCACCAGGGTGGCAGGGTGGG No data
994452136_994452146 8 Left 994452136 5:99956036-99956058 CCAGCCTCACTCCCATGCTTGCC No data
Right 994452146 5:99956067-99956089 AAGTCCATAGGGCACCAGGGTGG No data
994452136_994452143 4 Left 994452136 5:99956036-99956058 CCAGCCTCACTCCCATGCTTGCC No data
Right 994452143 5:99956063-99956085 TCCAAAGTCCATAGGGCACCAGG No data
994452136_994452150 16 Left 994452136 5:99956036-99956058 CCAGCCTCACTCCCATGCTTGCC No data
Right 994452150 5:99956075-99956097 AGGGCACCAGGGTGGCAGGGTGG No data
994452136_994452153 23 Left 994452136 5:99956036-99956058 CCAGCCTCACTCCCATGCTTGCC No data
Right 994452153 5:99956082-99956104 CAGGGTGGCAGGGTGGGTGCTGG No data
994452136_994452148 12 Left 994452136 5:99956036-99956058 CCAGCCTCACTCCCATGCTTGCC No data
Right 994452148 5:99956071-99956093 CCATAGGGCACCAGGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994452136 Original CRISPR GGCAAGCATGGGAGTGAGGC TGG (reversed) Intergenic