ID: 994455230

View in Genome Browser
Species Human (GRCh38)
Location 5:99997352-99997374
Sequence GGAGTCTGGTGTTCTGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994455227_994455230 -9 Left 994455227 5:99997338-99997360 CCTGTGGGCCAAGTGGAGTCTGG 0: 1
1: 1
2: 3
3: 26
4: 177
Right 994455230 5:99997352-99997374 GGAGTCTGGTGTTCTGAAACTGG 0: 1
1: 0
2: 0
3: 13
4: 151
994455226_994455230 -8 Left 994455226 5:99997337-99997359 CCCTGTGGGCCAAGTGGAGTCTG 0: 1
1: 0
2: 3
3: 18
4: 177
Right 994455230 5:99997352-99997374 GGAGTCTGGTGTTCTGAAACTGG 0: 1
1: 0
2: 0
3: 13
4: 151
994455220_994455230 29 Left 994455220 5:99997300-99997322 CCTTTCCAGGATGTCTACAAAAT No data
Right 994455230 5:99997352-99997374 GGAGTCTGGTGTTCTGAAACTGG 0: 1
1: 0
2: 0
3: 13
4: 151
994455221_994455230 24 Left 994455221 5:99997305-99997327 CCAGGATGTCTACAAAATGATAT 0: 1
1: 0
2: 0
3: 15
4: 162
Right 994455230 5:99997352-99997374 GGAGTCTGGTGTTCTGAAACTGG 0: 1
1: 0
2: 0
3: 13
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994455230 Original CRISPR GGAGTCTGGTGTTCTGAAAC TGG Intergenic
901368584 1:8776346-8776368 GGAGTATGGTGGTGTGATACTGG + Intronic
904004498 1:27356789-27356811 GGGGTCTGGGGTTCCCAAACGGG - Intronic
904975785 1:34455251-34455273 GGAGTTAGGTGTTCTGCATCTGG + Intergenic
908111698 1:60904516-60904538 TCAAACTGGTGTTCTGAAACAGG - Intronic
908962665 1:69718234-69718256 GGAGTTTGGTGCTGGGAAACAGG + Intronic
912938826 1:114027017-114027039 GGAGTCTGGAAGTCTGAAACTGG + Intergenic
916450559 1:164916551-164916573 GGAGACTGTTGTTGTAAAACTGG + Intergenic
917216891 1:172688276-172688298 GGAGTCTGATGTTCTGGGGCAGG + Intergenic
917932155 1:179830091-179830113 GGAGTCAGGTGTTCAAAGACTGG + Intergenic
918384965 1:183996499-183996521 GGACTCTGGAGCTCTGAAAAGGG + Intronic
919830245 1:201535849-201535871 GGAGTCAGGTCTTCTGAAGCTGG + Intergenic
920811262 1:209288014-209288036 GGAGTCTGCTGCTCAGAAAAGGG + Intergenic
922799004 1:228355641-228355663 GGACTCTGGAGTCCTGAAAGTGG - Intronic
1062872201 10:915025-915047 AAAGTCTGCTGTTCTGACACAGG - Intronic
1068553826 10:58435716-58435738 GAAGCCTGGGGATCTGAAACAGG - Intergenic
1070705643 10:78636012-78636034 GGTGTCAGGTGTGCTGAAACTGG + Intergenic
1075287448 10:121199391-121199413 GGAGTCTGGTGTTGGGAGACAGG + Intergenic
1076528485 10:131127750-131127772 AGAGTCTGCTGTTGTGACACGGG - Intronic
1078468516 11:11568667-11568689 GGAGTCTGGAGTTCTGGATTTGG + Intronic
1086544579 11:87952501-87952523 GGAATATGGTATTCTGAAAAAGG - Intergenic
1089741579 11:120588276-120588298 GGAGTATGGTGTTCTTGAAGTGG + Intronic
1090748857 11:129728744-129728766 GGTGACTGGGGTTATGAAACTGG + Intergenic
1096215627 12:49796264-49796286 GGAGTCTGGGGTTGTGTAGCAGG + Exonic
1096268382 12:50143219-50143241 GGAGACGGGTGTTCTGACTCTGG - Intronic
1097073874 12:56377634-56377656 GAAGTCTGGTGATCTGGAATGGG - Intergenic
1103151854 12:118647709-118647731 AGAGTTTGGTGGTCTGAAGCTGG + Intergenic
1103412482 12:120722313-120722335 AAAGTCTGGTGTTCTGTATCTGG + Exonic
1105492161 13:20899382-20899404 GGAGTCTGGTGATCTCAGCCTGG + Intronic
1105891740 13:24687033-24687055 TGAGTCTGGGGTTCTGGAAAAGG + Intronic
1109712365 13:66178247-66178269 GGAGTCTGGTGTTCGAGAGCAGG + Intergenic
1111523784 13:89440469-89440491 AGAGTCTGGTGTACTTAAACAGG + Intergenic
1113047092 13:106167928-106167950 GGAATCTGGTGCTCTGGAAACGG - Intergenic
1113134830 13:107077867-107077889 GGAGTAAGATGTTCTGAAAATGG + Intergenic
1113764030 13:112869735-112869757 GGAGGCTGCTGTGCTGTAACTGG - Intronic
1114874448 14:26698249-26698271 AGTGTTTGGTTTTCTGAAACTGG - Intergenic
1117023211 14:51593743-51593765 GTAGTCTGGTATCCAGAAACGGG - Intronic
1117201588 14:53395262-53395284 GGATTCTGTTGTTCAGCAACTGG + Intergenic
1118559150 14:67059352-67059374 GGAGCCTGGTCTCCTGGAACTGG - Intronic
1118980100 14:70709439-70709461 GGAGGCGAGTGCTCTGAAACAGG + Intergenic
1119522922 14:75299267-75299289 GGAGTTTTGTGCTCCGAAACAGG + Intergenic
1119962424 14:78874767-78874789 CAAGTCTGGGGTTCTGAATCAGG + Intronic
1120635052 14:86940650-86940672 GGGGTTTGGTGTTCTGCAGCTGG - Intergenic
1121738197 14:96233499-96233521 GGAGTCTGGTGTCCTGCTTCAGG + Intronic
1131379715 15:91953816-91953838 GGAGACGGGTGTTCGGATACAGG - Intronic
1133974609 16:10591694-10591716 GGAGTCTGGAGTGCTGCCACGGG - Intergenic
1135021957 16:18970309-18970331 GGTGTCTGTTTTTTTGAAACAGG + Intergenic
1138750973 16:59420590-59420612 GGAGTCTGATGTTCAAAAGCAGG + Intergenic
1144792741 17:17870313-17870335 TAAGTCTGCTGTTCTGGAACAGG - Intronic
1147202834 17:38814954-38814976 GCAGGCTGCTCTTCTGAAACAGG - Exonic
1150821555 17:68438407-68438429 GGATTCTAGTCTTGTGAAACTGG + Intronic
1151718656 17:75843930-75843952 GGAGTCGGCTCTTCTGAAGCTGG + Intronic
1151914830 17:77110155-77110177 AGAGCTTGGTGTTCTGAGACAGG - Intronic
1153261134 18:3225561-3225583 GGAGTCTGGGGCTCTGGAAGAGG - Intergenic
1156521159 18:37723360-37723382 GGAGGCTGGAGTGATGAAACTGG + Intergenic
1157064488 18:44331733-44331755 GGAGTCTGATGTTCAGGGACAGG - Intergenic
1158406526 18:57164855-57164877 GGAGTCTTTTGTTCTGAATAGGG + Intergenic
1159140744 18:64390982-64391004 GGAGACTGCTGTCCTGAAATTGG + Intergenic
1160224349 18:77000771-77000793 GGAGCTGGGCGTTCTGAAACTGG + Intronic
1163157557 19:15447793-15447815 GGAGTCTGGGGTGCTGAGATGGG + Intronic
1166984739 19:46652997-46653019 GGAGTCTGGGGGCCTGGAACAGG - Exonic
1167668066 19:50834158-50834180 GGAATCTGGTGTTTGGAATCTGG + Intronic
1168064412 19:53910805-53910827 GGAGTCTAATGTTATGAAATCGG + Intronic
1168064652 19:53912205-53912227 GGAGTCTGGTGTTCACAACCGGG + Intronic
925329887 2:3050377-3050399 GGACTCAGGTGTCCTGACACCGG + Intergenic
929854797 2:45627834-45627856 GGAGTCTGGGGGTCAGAAAGAGG - Intergenic
929920483 2:46167904-46167926 GGAGCCTGCTGTGCTGGAACAGG - Intronic
932128664 2:69168080-69168102 GGAGGCTGGTGTTCTGACAGTGG - Intronic
933770075 2:85738028-85738050 TGAGTCTGGTTTTCTGCTACAGG + Intergenic
936845020 2:116820938-116820960 GGAGTCTGATGTTCACAGACAGG + Intergenic
937175233 2:119924600-119924622 AAAGTTTAGTGTTCTGAAACTGG + Intronic
937800975 2:126079924-126079946 GGAGTCTGATGTTCGAAAGCAGG - Intergenic
939034690 2:137116753-137116775 GAAGTCTGGTGTTCTAGAATTGG + Intronic
939906257 2:147919663-147919685 AGATCCTGGTGTTCTGAAAAGGG - Intronic
940191406 2:151044277-151044299 GGAATCTAATGTTCTCAAACTGG - Intronic
941909331 2:170747917-170747939 GCAGTCTGCTGTGCTGATACAGG + Intergenic
944142308 2:196470241-196470263 GGAGTATAGTGGTCAGAAACTGG - Intronic
946791263 2:223302645-223302667 GGAGTCTGATGTTCAAAGACAGG - Intergenic
1169013872 20:2275353-2275375 GGAGTTTGGGGTTCTGAGAAGGG - Intergenic
1170716951 20:18840104-18840126 GGAGTCTGCCTTTGTGAAACAGG - Intergenic
1175292988 20:57890698-57890720 TGAGGGTGGTGTGCTGAAACTGG + Intergenic
1176383926 21:6127643-6127665 GGAGTCTGCTGTTCGGAGGCGGG + Intergenic
1177778657 21:25598993-25599015 GGAGTCTGGAGATCTGAAAAGGG - Intronic
1177893952 21:26839840-26839862 GGACTCTGGTTTTAAGAAACTGG - Intronic
1178351054 21:31873393-31873415 GGATCCTGGTGTCCTGAAAGGGG + Exonic
1179193666 21:39144635-39144657 GGAGGCTGGCATTCTGGAACAGG + Intergenic
1179523756 21:41962160-41962182 GGTCCCTGGTGTTCTGAAGCAGG + Intergenic
1179739548 21:43410595-43410617 GGAGTCTGCTGTTCGGAGGCGGG - Intergenic
1180976255 22:19850439-19850461 CGTGCCTGGTGTTCTGAAGCAGG - Exonic
1181413811 22:22745317-22745339 GGTGTCCTGAGTTCTGAAACTGG - Intronic
1184527214 22:45031676-45031698 GGATTCTGGTGTTCTAATAGAGG + Intergenic
950174868 3:10866089-10866111 GGAGTCTGGGTCCCTGAAACTGG - Intronic
953272309 3:41457648-41457670 GGAGTCTGATGTTGGGAAATTGG - Intronic
954327383 3:49870907-49870929 TGAGTCTGGTCTTCAGATACTGG - Intergenic
956730867 3:72195409-72195431 GGAGTCTGATGTTCAGGGACAGG + Intergenic
957169878 3:76724597-76724619 GGGGTCTGGAGGTATGAAACAGG - Intronic
962532570 3:136297329-136297351 GGAGTCTGGTGGGATGAACCTGG + Intronic
963063860 3:141246948-141246970 GGACTCTGGTGAGCTGAGACAGG - Intronic
964726669 3:159820747-159820769 GGAGTCTGGAGTTCAGAAGAAGG + Intronic
967705523 3:192645528-192645550 GAAGTCAGCAGTTCTGAAACTGG - Intronic
969484383 4:7463899-7463921 GGAGGCTGGTGATTTCAAACAGG + Intronic
974474954 4:62366521-62366543 GGAGTCTGATGTTCGAACACAGG - Intergenic
977045985 4:92070122-92070144 GAAGAATGGTGTTTTGAAACAGG + Intergenic
982798990 4:159679468-159679490 GTAGACTGCTGCTCTGAAACTGG + Intergenic
982945418 4:161616420-161616442 GGAGTCTGGTGTTCAAAGGCAGG - Intronic
983313890 4:166101404-166101426 TGTGTCTGGTGTTTGGAAACTGG + Exonic
985108365 4:186521089-186521111 GGAGGCTGGTGGTCTGGGACAGG - Intronic
985382933 4:189414261-189414283 GTAGTCTAGTCTTCAGAAACAGG - Intergenic
985619795 5:948180-948202 GGGGTGTGGTCTTCTGACACTGG - Intergenic
985908808 5:2863436-2863458 GGAGCCTGGTGTCCTGGCACTGG + Intergenic
985918844 5:2950177-2950199 GGAGGCTGGTGTTCTTGACCAGG + Intergenic
986955961 5:13149647-13149669 GGAGTCTGATGTTCTAGAGCAGG + Intergenic
990227452 5:53671331-53671353 GAAGGCTGGTGTTCTGAAATTGG + Intronic
990744165 5:58941818-58941840 GGAATCTGTTGTCCTGAAAAGGG + Intergenic
993417683 5:87655685-87655707 GCAGGCTGGTGTTCAGAATCTGG + Intergenic
994455230 5:99997352-99997374 GGAGTCTGGTGTTCTGAAACTGG + Intergenic
997292558 5:132747994-132748016 GCGCTCGGGTGTTCTGAAACTGG + Intronic
1000009304 5:157216739-157216761 GGAGACTGGTGTTCTAACTCTGG - Intronic
1006473053 6:34238682-34238704 GGCCTCTGATGTTCAGAAACAGG + Intronic
1012920406 6:105216643-105216665 GGAGTCTGATGTTCAAGAACAGG + Intergenic
1015155670 6:130092814-130092836 GTAGGCTGGTGTTCAAAAACAGG + Exonic
1015172944 6:130274712-130274734 GGAATCTGGAGTTCTGATAAAGG + Intronic
1017130167 6:151101669-151101691 GGAGTATGGTGTTCGGCAAAAGG + Exonic
1017247211 6:152239571-152239593 GGCTTCTGCTGTACTGAAACGGG - Exonic
1019175268 6:170156421-170156443 GGAGGCAGTTGTTCTGAACCAGG + Intergenic
1019263242 7:94297-94319 GGATTCTGGGGTTCTCACACTGG - Intergenic
1019906251 7:4067366-4067388 GGAGCCTGGAGTTCTGGACCAGG + Intronic
1020872442 7:13648790-13648812 AGAGTCTTGTGTTCTGAATCAGG + Intergenic
1020972233 7:14958924-14958946 GGATTCTGATATTCTGAATCTGG - Intronic
1022220108 7:28306094-28306116 AGAGTCTGGCTTTCTCAAACAGG - Intronic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1024222540 7:47299769-47299791 GGAGCCTGGTGTGCTGAAGTTGG + Intronic
1026931351 7:74224553-74224575 GGAGTCTGGGGGTCTGAGTCTGG + Intronic
1028109504 7:86921720-86921742 GCAGTCTGGAGTTCTGAGTCAGG - Intronic
1028850622 7:95533477-95533499 GGAGTTGGGTGGACTGAAACAGG - Intronic
1028928651 7:96388634-96388656 AGAGTCTGGGGTGGTGAAACTGG + Intergenic
1030097669 7:105915291-105915313 CTAGCTTGGTGTTCTGAAACTGG - Intronic
1031007666 7:116492382-116492404 GGAGTGTGGTCTTCTAAAGCAGG + Intronic
1031403421 7:121353634-121353656 GGAGTCTGGTATTTTGCAACAGG + Intronic
1032487361 7:132297907-132297929 GAGGCTTGGTGTTCTGAAACAGG - Intronic
1035369163 7:158367948-158367970 GGAATTTGGTGTCTTGAAACAGG - Intronic
1039019189 8:33186304-33186326 GGAGTCTGATGTTCAAAATCAGG + Intergenic
1039032730 8:33327543-33327565 TGAGTTTTGTTTTCTGAAACAGG - Intergenic
1041045663 8:53883529-53883551 GGAGTCTTGAGCTCTGTAACTGG + Intronic
1045947287 8:107810912-107810934 GAAGTCCAGAGTTCTGAAACAGG + Intergenic
1050336066 9:4591038-4591060 GGAGTCTGGAGATCTAACACTGG + Intronic
1052050507 9:23842422-23842444 GGAGGCTGGTTTTCTGCAACAGG - Intergenic
1052443820 9:28533200-28533222 GGAGTCTGATGTTCTAGGACAGG - Intronic
1053819663 9:41953379-41953401 GGAGTCTGCTGAGCAGAAACGGG + Exonic
1054109930 9:61097032-61097054 GGAGTCTGCTGAGCAGAAACGGG + Intergenic
1054610927 9:67234093-67234115 GGAGTCTGCTGAGCAGAAACGGG - Intergenic
1058090807 9:100803513-100803535 GGAGTCTGGTGTTCGAAGGCAGG + Intergenic
1058153710 9:101488346-101488368 GGAGTCTGATATTCCGAAATTGG + Intronic
1058481088 9:105395965-105395987 GGGGGCTGGTGATTTGAAACAGG + Exonic
1060308568 9:122438680-122438702 GGAGTCTGATGTTCGGGGACAGG + Intergenic
1186546886 X:10459207-10459229 GGAGTCTGTGGTTCTCAATCAGG - Intronic
1186699023 X:12069565-12069587 TGAATCTGGTGTTCTGACAAGGG + Intergenic
1187126967 X:16462943-16462965 CGAGTGTGGTGTGGTGAAACTGG + Intergenic
1187562779 X:20418406-20418428 GGAGACTGGTGTTCAGCAAAGGG - Intergenic
1189176909 X:38966727-38966749 GGAGTCTTCTGTTCTGCATCTGG - Intergenic
1190637619 X:52451805-52451827 GGAGTCTGATGTTCGAAGACAGG + Intergenic
1191742503 X:64450883-64450905 GGAGTCTGATGTTCAAAGACAGG + Intergenic
1191878011 X:65815956-65815978 GGAGTCTGATGTTCTAAGGCAGG + Intergenic
1196027206 X:111053783-111053805 GGAGTATGGTGGTGTGAACCTGG - Intronic
1198260829 X:134963398-134963420 GGAAACTGGTGGTCTGAAATAGG - Intergenic
1198412170 X:136381829-136381851 GGAGTCTGATGTTCTAAGGCAGG + Intronic