ID: 994457317

View in Genome Browser
Species Human (GRCh38)
Location 5:100027898-100027920
Sequence TGCCTTACACCAAGATTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994457317_994457322 25 Left 994457317 5:100027898-100027920 CCTGAAAATCTTGGTGTAAGGCA No data
Right 994457322 5:100027946-100027968 TAATCCAGAAGGTCTAGGGTAGG No data
994457317_994457321 21 Left 994457317 5:100027898-100027920 CCTGAAAATCTTGGTGTAAGGCA No data
Right 994457321 5:100027942-100027964 TTTCTAATCCAGAAGGTCTAGGG No data
994457317_994457320 20 Left 994457317 5:100027898-100027920 CCTGAAAATCTTGGTGTAAGGCA No data
Right 994457320 5:100027941-100027963 GTTTCTAATCCAGAAGGTCTAGG No data
994457317_994457319 14 Left 994457317 5:100027898-100027920 CCTGAAAATCTTGGTGTAAGGCA No data
Right 994457319 5:100027935-100027957 ATCAGAGTTTCTAATCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994457317 Original CRISPR TGCCTTACACCAAGATTTTC AGG (reversed) Intergenic
No off target data available for this crispr