ID: 994457322

View in Genome Browser
Species Human (GRCh38)
Location 5:100027946-100027968
Sequence TAATCCAGAAGGTCTAGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994457317_994457322 25 Left 994457317 5:100027898-100027920 CCTGAAAATCTTGGTGTAAGGCA No data
Right 994457322 5:100027946-100027968 TAATCCAGAAGGTCTAGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994457322 Original CRISPR TAATCCAGAAGGTCTAGGGT AGG Intergenic
No off target data available for this crispr