ID: 994458223

View in Genome Browser
Species Human (GRCh38)
Location 5:100041777-100041799
Sequence AGCAGGGAGTTGAGGGTCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994458220_994458223 -9 Left 994458220 5:100041763-100041785 CCTGTTACAGAGAGAGCAGGGAG No data
Right 994458223 5:100041777-100041799 AGCAGGGAGTTGAGGGTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994458223 Original CRISPR AGCAGGGAGTTGAGGGTCTT AGG Intergenic
No off target data available for this crispr