ID: 994458494

View in Genome Browser
Species Human (GRCh38)
Location 5:100046283-100046305
Sequence CATCATGTGGAGATATTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 1, 2: 6, 3: 16, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994458489_994458494 -2 Left 994458489 5:100046262-100046284 CCAAGAAATGAGCCGAAGTTCCA 0: 1
1: 0
2: 5
3: 19
4: 93
Right 994458494 5:100046283-100046305 CATCATGTGGAGATATTGGATGG 0: 1
1: 1
2: 6
3: 16
4: 151
994458486_994458494 28 Left 994458486 5:100046232-100046254 CCTGTGATGATTTGGAGGATTAG 0: 1
1: 2
2: 6
3: 27
4: 121
Right 994458494 5:100046283-100046305 CATCATGTGGAGATATTGGATGG 0: 1
1: 1
2: 6
3: 16
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994458494 Original CRISPR CATCATGTGGAGATATTGGA TGG Intergenic
908398272 1:63746201-63746223 CATCATGTGGAAATAATTGCAGG - Intergenic
909008149 1:70301604-70301626 CAGGGTGTGGAGATATTGGTTGG - Intronic
910027318 1:82671038-82671060 GATAATGTGGAGGTACTGGAGGG + Intergenic
910409851 1:86930443-86930465 CTTCATGTGGGGATAGAGGAAGG - Intronic
910637158 1:89421482-89421504 CATCAGGTGAAGATTTTGGTTGG - Intergenic
911959694 1:104285446-104285468 CATCATGTGGAGAGGTTTGTTGG - Intergenic
921063552 1:211606870-211606892 CATCACTTGGAGATGTTGTAAGG - Intergenic
923613875 1:235520039-235520061 CATCATGCAGAAATATTTGATGG - Intergenic
923774137 1:236963267-236963289 CCTGATGTGGTGGTATTGGAGGG - Intergenic
1068531332 10:58189980-58190002 CATCTTGTGGAGATAGTGCACGG - Intergenic
1070118371 10:73551223-73551245 CATCATATGGAGACATTTGTAGG - Intronic
1071096697 10:81983817-81983839 CAGGATGTGGACATATTTGAAGG - Intronic
1071749248 10:88456149-88456171 CAGCATGGGGAGACATTGCATGG - Intronic
1071883439 10:89924263-89924285 CTTCATGGGGATATATTGCAAGG - Intergenic
1076298733 10:129407516-129407538 CATCCTATGGAGATTTTGGACGG - Intergenic
1078445216 11:11399183-11399205 CATCATGTAAAGATATGAGAAGG + Intronic
1079103082 11:17553415-17553437 CACCACGTGGAGACATTTGATGG + Exonic
1079919858 11:26419288-26419310 CATCAGGTGGAGATTTGGGTAGG + Intronic
1084142759 11:67244448-67244470 CAGGATGAGGAAATATTGGAGGG + Intronic
1085467396 11:76733600-76733622 CTCAATGTGGAGATATTGGGAGG - Intergenic
1086533644 11:87816065-87816087 CATCATGTAGAGATGTTAGATGG + Intergenic
1086807259 11:91260010-91260032 CAACAAGAAGAGATATTGGAAGG + Intergenic
1087470056 11:98561684-98561706 AATCATGTGGACATGTTGAAAGG - Intergenic
1087588573 11:100154651-100154673 GAGGATGTGGAGAGATTGGAGGG - Intronic
1098126253 12:67296740-67296762 AATCATTTAGAGATTTTGGAAGG + Intronic
1100124663 12:91408820-91408842 AATCACCTGCAGATATTGGAGGG + Intergenic
1100124810 12:91411069-91411091 AATCACCTGCAGATATTGGAGGG + Intergenic
1102582687 12:113900798-113900820 CATCCTCTGGACATATTGGTAGG + Intronic
1104372884 12:128238746-128238768 CATCTTGTAGAGACTTTGGAGGG + Intergenic
1104933789 12:132353950-132353972 CATCATCTGGAGAGACAGGAAGG + Intergenic
1107615732 13:42165357-42165379 GACCAAGTGGACATATTGGATGG - Exonic
1108543916 13:51471922-51471944 CACCATGTGGAGATAGAAGACGG + Intergenic
1109861688 13:68207819-68207841 GATCAGGTGGAGTTTTTGGAGGG - Intergenic
1110457601 13:75707875-75707897 GATCATGTGTAGATATATGAGGG - Intronic
1110584982 13:77179145-77179167 AATAATGTGTATATATTGGATGG + Intronic
1110789422 13:79570655-79570677 CCTCATGATGAGAGATTGGAAGG + Intergenic
1111676158 13:91391300-91391322 GATCATTTGGAAATATTGGCAGG + Intergenic
1112056626 13:95694638-95694660 CATCATGTAGAGATGTTGGATGG - Intronic
1115074934 14:29377052-29377074 CATGATTTTGAGATATTGAAAGG + Intergenic
1116865488 14:50028445-50028467 CCTCATGTGGAGATTTTGCAGGG - Intergenic
1117123755 14:52596963-52596985 CACCATTTGGAGATATAAGATGG - Intronic
1118505852 14:66410917-66410939 CATCATATGCAAATATCGGAAGG - Intergenic
1120412640 14:84176486-84176508 CATCATATAGAAATATTCGATGG - Intergenic
1121797375 14:96746293-96746315 CACCTCGTGGGGATATTGGAAGG + Intergenic
1123477087 15:20597877-20597899 CATCTTGTGGGGAGAGTGGATGG + Intergenic
1123640926 15:22402487-22402509 CATCTTGTGGGGAGAGTGGATGG - Intergenic
1125383038 15:39107716-39107738 CACCATGAGGAAATATTGGCAGG - Intergenic
1127351272 15:58155029-58155051 CATCATGTAGAAATGTTGGATGG - Intronic
1128116556 15:65110942-65110964 CATCATGTGGAGAGGTAGGGTGG + Intronic
1130061640 15:80574659-80574681 CATCATGTGGAGATAGGAGAAGG - Intronic
1130984048 15:88833264-88833286 CATTATGTGGAGATTTGGTAGGG - Intronic
1131018489 15:89077618-89077640 CACCCTGTGGAGTTATTGGGAGG + Intergenic
1131608619 15:93936767-93936789 CATCATTTGCTGATTTTGGAGGG + Intergenic
1133992519 16:10719671-10719693 CATCATGTGGAAATGTTGGACGG + Intergenic
1135817944 16:25653014-25653036 CAGCATGTGCAGAGATTGCATGG + Intergenic
1141226551 16:82121678-82121700 CATCATGTAGAAATGTTAGAGGG + Intergenic
1145399481 17:22519647-22519669 CATCATATGGAGATGTTGGATGG - Intergenic
1149412781 17:56426114-56426136 AATTATGTGGACTTATTGGAGGG - Intronic
1149414051 17:56439702-56439724 AATGATGTGGAGATAATGAAAGG + Intronic
1149508415 17:57215720-57215742 CATAATGGGGAGAGAATGGAAGG + Intergenic
1149619592 17:58033465-58033487 CAGCATGTGTAGAGATTGCATGG + Intergenic
1157950952 18:52036339-52036361 AACCAGTTGGAGATATTGGATGG + Intergenic
1158199492 18:54924105-54924127 AATTATGTTGAGACATTGGAAGG - Intronic
1158319496 18:56247729-56247751 CATCTTGTGCAGCTATTGAATGG - Intergenic
1158634148 18:59141076-59141098 CATCATGTTGAGATGTGGGGTGG + Intronic
1159390048 18:67780272-67780294 GATCATGTGGAGAGATGGGGTGG - Intergenic
1159896106 18:73997324-73997346 CAACATGTGGAGATTATGGGAGG - Intergenic
1160410016 18:78668840-78668862 GAACATGTGGAGATACAGGAAGG + Intergenic
1164756293 19:30692061-30692083 AATCATGTGGATATACAGGAAGG + Intronic
1167624175 19:50576285-50576307 CATCATGGGGACTTTTTGGAGGG - Intergenic
1167788457 19:51655406-51655428 CATCATGTGGACATCATTGAAGG + Intergenic
1167811153 19:51831663-51831685 CATGATGGGAAGCTATTGGAGGG - Intergenic
927587640 2:24322463-24322485 CAACATGTGGAGATAATTCAAGG + Intronic
928365052 2:30694064-30694086 CTTCATGTGGAGTGAGTGGAAGG + Intergenic
933478090 2:82818200-82818222 CATCATGTAGAAATGTTAGATGG - Intergenic
937481428 2:122264137-122264159 CATCCTGTGGATATATGCGATGG + Intergenic
938309886 2:130282749-130282771 CATCATATAGAGATATGAGATGG - Intergenic
938445031 2:131369620-131369642 CATCATATAGAGATATGAGATGG + Intergenic
940433735 2:153625810-153625832 CAGAATGAGGAGATGTTGGAGGG + Intergenic
940449496 2:153819121-153819143 AATGGTGTGGTGATATTGGATGG - Intergenic
940562327 2:155314102-155314124 CATCATGTAGTAATATTAGATGG - Intergenic
940607465 2:155944877-155944899 AATCATATGGTGATATTAGAAGG + Intergenic
942028006 2:171930031-171930053 CATCATGTTCATATACTGGAAGG - Intronic
943204607 2:184877408-184877430 CATCATGTGGAGATTTGAGAAGG + Intronic
944298846 2:198099269-198099291 TATCATTTAGAGATCTTGGAAGG + Intronic
947068029 2:226252423-226252445 CATCATGTGGTGAGAAAGGAAGG + Intergenic
948340951 2:237251203-237251225 CATAATGTGGAATTAATGGAAGG - Intergenic
1171086886 20:22245803-22245825 AATCATGTGGAAATACTGGATGG + Intergenic
1179281112 21:39935210-39935232 AATGATGTGGTGATATTGGAGGG - Intergenic
1179915139 21:44472419-44472441 CATCATGCAGAGATAGTTGATGG + Intergenic
1181337976 22:22155176-22155198 CATCATGGGGAGATGATGGTGGG + Intergenic
1182860889 22:33558306-33558328 CTTCATTTGGAGATAAGGGAAGG + Intronic
951190758 3:19768248-19768270 GAGAATGTGGAGAAATTGGAAGG + Intergenic
951985317 3:28613354-28613376 CATTATGTGTGGATTTTGGAGGG + Intergenic
955141956 3:56278321-56278343 AATCATGCGAAGATATGGGAAGG + Intronic
955981384 3:64530943-64530965 CATAATGTATAGATTTTGGAGGG + Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956792046 3:72687424-72687446 CATCATGTGTAAAAAGTGGACGG - Intergenic
956918460 3:73899999-73900021 CTTCATGTGAAAATACTGGAAGG + Intergenic
957651238 3:83007957-83007979 CATCATATGGAGTTATTTGTGGG - Intergenic
960420776 3:117442732-117442754 CATCATGTGGGCTTTTTGGAAGG + Intergenic
960689141 3:120325730-120325752 CATCTTATGAAGATATTGTAAGG - Exonic
961795628 3:129406844-129406866 CTTCATTTGGAGATTTTGGTGGG + Intronic
962491291 3:135896544-135896566 CATTGTGTGGAGAAACTGGAGGG + Intergenic
963821507 3:149899893-149899915 AATCAAATGGAGATATTGAATGG + Intronic
964414440 3:156432705-156432727 CATAAGGTGGAGATATGGGAAGG - Intronic
965523733 3:169695374-169695396 CATCATGTTTAGATATGAGATGG + Intergenic
968941426 4:3640694-3640716 CGTCATGTGGAGGAATGGGAGGG + Intergenic
969938809 4:10709861-10709883 CATGATGGGGTGATCTTGGATGG - Intergenic
969973024 4:11067423-11067445 CATCATGTGAAGATGAAGGAGGG - Intergenic
971151814 4:24041208-24041230 GATTAGGTTGAGATATTGGAAGG + Intergenic
971525093 4:27606844-27606866 CATCATGTGATGCTATTTGAAGG - Intergenic
974639343 4:64608740-64608762 CATCATATAGAGATATTGGATGG + Intergenic
975286732 4:72630056-72630078 CATGATCTGCACATATTGGAAGG - Intergenic
982469212 4:155766650-155766672 TGTCATGTGGATGTATTGGAAGG + Intronic
986088059 5:4472788-4472810 CAACAGCTGGAGATTTTGGAAGG + Intergenic
986858320 5:11898185-11898207 CAGCATGTTGGGATATTGGAAGG - Intronic
990053785 5:51543984-51544006 CATTATGTGGTGATATGGTACGG - Intergenic
991631057 5:68656744-68656766 CATCATGTGGAGATCCTGCTTGG + Intergenic
993983447 5:94569609-94569631 CATCATGTGGAGATGTTAGATGG - Intronic
994458494 5:100046283-100046305 CATCATGTGGAGATATTGGATGG + Intergenic
997570536 5:134923958-134923980 CATCATGCGGAGATATTGGATGG + Intronic
998027022 5:138826392-138826414 TATCAAGTGGAGGAATTGGAGGG + Intronic
1000245193 5:159443195-159443217 CATGATGTGGATGTATTGGTAGG + Intergenic
1001537344 5:172507533-172507555 CATCTTCTGGAGAAACTGGAAGG + Intergenic
1003471930 6:6444514-6444536 AAGGATGTGGAGAAATTGGAAGG + Intergenic
1005569083 6:27127219-27127241 CATCTTGTGGCGATAATGGATGG - Intronic
1005995619 6:30929466-30929488 TTTCATATGGAGATAATGGAGGG + Intergenic
1007499123 6:42281865-42281887 CACCATGTGGGGTTATTGGGAGG - Intronic
1011787374 6:90862204-90862226 CACCAGGTGGAGAAACTGGAAGG + Intergenic
1011908259 6:92401497-92401519 CATCATGTAATGATATTTGATGG + Intergenic
1012789310 6:103673695-103673717 CATCATAGGCAAATATTGGAGGG + Intergenic
1013865031 6:114686017-114686039 CTACATGTTGAGATATTGGCTGG - Intergenic
1016370609 6:143370155-143370177 CATCTTGTGGGGAAATTTGAGGG + Intergenic
1020881187 7:13764915-13764937 AATCATGTGCAGAGATTGCATGG - Intergenic
1021525251 7:21579172-21579194 CATCATGAGAAGCTATTGAAGGG - Intronic
1021642153 7:22748721-22748743 CACCATGTGGAAATATTTGATGG + Intergenic
1025226899 7:57173428-57173450 CATCATATAGAGATATTAGATGG - Intergenic
1025229966 7:57196709-57196731 CATCATATAGAGATATTAGATGG - Intergenic
1025485330 7:61040308-61040330 AATCAAGTGGAGAAATTGAATGG + Intergenic
1039307524 8:36278795-36278817 CGTCATATAGAAATATTGGATGG + Intergenic
1039637607 8:39183034-39183056 CATCAGGTGGGGATACTGGCTGG + Intronic
1040377287 8:46838614-46838636 CATCATGTGGAAATGTTAGGTGG + Intergenic
1040776716 8:51052734-51052756 CATGATGTTAAGATAATGGAAGG - Intergenic
1041438285 8:57865602-57865624 CAGGATGTGGAGCAATTGGAAGG - Intergenic
1041692711 8:60704548-60704570 CACCATGTGCATAGATTGGAAGG + Intronic
1041837625 8:62234081-62234103 TATCATGTGGTGATATTAGTGGG - Intergenic
1042331213 8:67582613-67582635 CATCATGTAGAAATTTTAGATGG + Intronic
1043517797 8:81012170-81012192 TATCATGTGGTAATAATGGAAGG - Intronic
1043618351 8:82156260-82156282 CAAGATGTGGACATTTTGGAAGG + Intergenic
1043723054 8:83572161-83572183 CATAATTTGGTGGTATTGGAAGG + Intergenic
1044197670 8:89396896-89396918 CATCATGTGTGAATATAGGATGG + Intergenic
1044781525 8:95748555-95748577 CATGATGATCAGATATTGGAAGG + Intergenic
1046099186 8:109594801-109594823 AAGCATGTCAAGATATTGGAAGG - Intronic
1046207848 8:111025442-111025464 CATCATTTGAAGTTATTGAAAGG + Intergenic
1046378450 8:113419471-113419493 CATCATCTGGTGATTTTTGAAGG + Intronic
1046604055 8:116351051-116351073 CATCACGTGGAGATGGTGGTGGG - Intergenic
1046647516 8:116802222-116802244 TAGGATATGGAGATATTGGAGGG + Intronic
1048296417 8:133217880-133217902 CTGCATGTGGAGACTTTGGAGGG - Intronic
1054923653 9:70566451-70566473 CAGCATGTGGAGGCTTTGGAAGG + Intronic
1055760946 9:79607003-79607025 GATGATGTGGAGAAATAGGAAGG - Intronic
1057251929 9:93510270-93510292 GATCATGTGGCCATTTTGGAAGG + Intronic
1058129543 9:101234356-101234378 CATCATGTGGAGAGTTTTAATGG + Intronic
1059843464 9:118244111-118244133 CAACATGTGGAGATTATGGGAGG + Intergenic
1060371320 9:123074894-123074916 CATAAAGTGGAAATACTGGATGG - Intronic
1202630805 M:14816-14838 CATCATGCGGAGATGTTGGATGG - Intergenic
1186013963 X:5169581-5169603 CATCATATAGAGATATTAGATGG - Intergenic
1186108768 X:6233150-6233172 CTTCATGTGGTGAGATGGGAAGG + Intergenic
1186118668 X:6333710-6333732 AATAATGTGGAGATATTTGCAGG - Intergenic
1192421075 X:71031550-71031572 CACTTGGTGGAGATATTGGAAGG + Intergenic
1194663733 X:96655059-96655081 CAACTTCTGAAGATATTGGATGG - Intergenic
1197089670 X:122521537-122521559 CAACATGTGGAGATTATGAAAGG + Intergenic
1200894826 Y:8364099-8364121 CATCATGTAGAAATGTTAGATGG - Intergenic
1200962290 Y:9006651-9006673 CATGATGTCTAGATGTTGGAAGG + Intergenic
1200981617 Y:9267861-9267883 CATGATGTCTAGATGTTGGAAGG - Intergenic