ID: 994459088

View in Genome Browser
Species Human (GRCh38)
Location 5:100050937-100050959
Sequence GGTCGAAGCCACATTCGTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 1, 2: 1, 3: 1, 4: 32}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994459088 Original CRISPR GGTCGAAGCCACATTCGTAA GGG Intergenic
912858068 1:113189511-113189533 GGGAGAAGCCACATTTGCAATGG - Intergenic
923380651 1:233414515-233414537 TGGGGAAGCCACATTTGTAAAGG - Intergenic
1062792188 10:314785-314807 GGTGGAAGTCCCATTCGTGAGGG + Intronic
1063889682 10:10616873-10616895 GGTCCCAGCTACATGCGTAATGG - Intergenic
1083939295 11:65886932-65886954 GGTAGAAGCAACATGAGTAAAGG + Intronic
1093246439 12:16743743-16743765 GGCCTAAGTCACATTCTTAAAGG - Intergenic
1105626004 13:22113214-22113236 GGTCAAACCCGCATTCGTAAGGG + Intergenic
1202927422 14_KI270725v1_random:1296-1318 GGTCTAAGCAATATTCTTAAAGG + Intergenic
1133992871 16:10723643-10723665 GATCAAATCCACATTCATAAGGG + Intergenic
1136934333 16:34444856-34444878 GGTAAAAGCCACATGAGTAAAGG - Intergenic
1136970239 16:34966958-34966980 GGTAAAAGCCACATGAGTAAAGG + Intergenic
1142921862 17:3195441-3195463 GGTCTAAGCTAAATTAGTAAAGG + Intergenic
1143476438 17:7206061-7206083 GGATGAGGCCACATTGGTAAGGG - Intronic
1147933520 17:43997736-43997758 GGTCGAAGCCGCATTCGTAAGGG - Intronic
1155771683 18:29709237-29709259 CGTTGAAGCCACATCCTTAAGGG - Intergenic
1157343861 18:46805634-46805656 GGTGGCAGCCAAATTTGTAATGG + Intergenic
1161537065 19:4826187-4826209 GGAAGATGCCTCATTCGTAATGG + Intronic
1162911475 19:13850225-13850247 GGTCGAGGCCATTTTCCTAAGGG - Intergenic
932743891 2:74315093-74315115 GGTCAAATCCACAGTCATAATGG + Intronic
1176589449 21:8629976-8629998 GGTCTAAGCAATATTCTTAAAGG + Intergenic
1180272277 22:10606973-10606995 GGTCTAAGCAATATTCTTAAAGG + Intergenic
949137855 3:591747-591769 GGTCTAAGCAATATTCTTAAAGG - Intergenic
953524466 3:43677200-43677222 GGTGGAAGCCATCTTCCTAAGGG + Intronic
959483052 3:106896695-106896717 GGTCAAAGCCGCATTCATAGGGG + Intergenic
965238555 3:166160991-166161013 GGTCAAATCCGCATTCGTAGGGG + Intergenic
971335536 4:25720317-25720339 GGTCAAATCCACATTCATAGGGG + Intergenic
988640174 5:33033066-33033088 GGTCAAAGCCACATGAGGAAGGG - Intergenic
994459088 5:100050937-100050959 GGTCGAAGCCACATTCGTAAGGG + Intergenic
1025226442 7:57168830-57168852 GGTCAAATCCGCATTCGTAGGGG - Intergenic
1036946379 8:13098931-13098953 GGTAGAAGCAACATTAGCAATGG + Intronic
1048337763 8:133515505-133515527 GGTCAAAACCTCATTCGTAGGGG - Intronic
1056835829 9:89954313-89954335 GGTGGAAGCCACATTCTCCAGGG + Intergenic
1057127912 9:92633799-92633821 GCTCATTGCCACATTCGTAATGG + Intronic
1058180617 9:101793630-101793652 GGTCGAATCCGCATTCATAGGGG + Intergenic
1202630198 M:10163-10185 GGTCGAAGCCGCACTCGTAAGGG - Intergenic
1203619459 Un_KI270749v1:108603-108625 GGTCTAAGCAATATTCTTAAAGG + Intergenic