ID: 994461982

View in Genome Browser
Species Human (GRCh38)
Location 5:100076183-100076205
Sequence AATCCCACCCCCTATGTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994461979_994461982 -6 Left 994461979 5:100076166-100076188 CCCCATTTCTGTTCTTTAATCCC No data
Right 994461982 5:100076183-100076205 AATCCCACCCCCTATGTTATAGG No data
994461981_994461982 -8 Left 994461981 5:100076168-100076190 CCATTTCTGTTCTTTAATCCCAC No data
Right 994461982 5:100076183-100076205 AATCCCACCCCCTATGTTATAGG No data
994461980_994461982 -7 Left 994461980 5:100076167-100076189 CCCATTTCTGTTCTTTAATCCCA No data
Right 994461982 5:100076183-100076205 AATCCCACCCCCTATGTTATAGG No data
994461978_994461982 -5 Left 994461978 5:100076165-100076187 CCCCCATTTCTGTTCTTTAATCC No data
Right 994461982 5:100076183-100076205 AATCCCACCCCCTATGTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994461982 Original CRISPR AATCCCACCCCCTATGTTAT AGG Intergenic
No off target data available for this crispr