ID: 994465383

View in Genome Browser
Species Human (GRCh38)
Location 5:100121978-100122000
Sequence ATTGATCTTCTTATCTCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994465383_994465386 3 Left 994465383 5:100121978-100122000 CCATGAGAGATAAGAAGATCAAT No data
Right 994465386 5:100122004-100122026 GAGCGTTTCAAGGATACTACTGG No data
994465383_994465385 -7 Left 994465383 5:100121978-100122000 CCATGAGAGATAAGAAGATCAAT No data
Right 994465385 5:100121994-100122016 GATCAATGAGGAGCGTTTCAAGG No data
994465383_994465388 29 Left 994465383 5:100121978-100122000 CCATGAGAGATAAGAAGATCAAT No data
Right 994465388 5:100122030-100122052 CCTGCAATAAAGTTCACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994465383 Original CRISPR ATTGATCTTCTTATCTCTCA TGG (reversed) Intergenic
No off target data available for this crispr