ID: 994465386

View in Genome Browser
Species Human (GRCh38)
Location 5:100122004-100122026
Sequence GAGCGTTTCAAGGATACTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994465382_994465386 16 Left 994465382 5:100121965-100121987 CCAATAATTTAATCCATGAGAGA No data
Right 994465386 5:100122004-100122026 GAGCGTTTCAAGGATACTACTGG No data
994465383_994465386 3 Left 994465383 5:100121978-100122000 CCATGAGAGATAAGAAGATCAAT No data
Right 994465386 5:100122004-100122026 GAGCGTTTCAAGGATACTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994465386 Original CRISPR GAGCGTTTCAAGGATACTAC TGG Intergenic
No off target data available for this crispr